Please fully answer and explain the following question
Attachment 1
Attachment 2
Part 3: Molecular Evolution Exercise Below are reported nucleotide sequences for an intron in the same gene for 4 different species of animals. CGTGAAAATGGAAACACATTCCTGGGGGTGCTATACGCG CGTAGAAAGGGAGAGACTATCATGGAGGCCCGATCTGCG CGTGAAAATGGATACACAGTCCTGGTGGTGCTATGCGCG CGTGCAAATGGACACACACTCGTGGCGGAACAATTAGCG

Leave a Reply

Your email address will not be published. Required fields are marked *